A3F-Cas9n-UGI
(Plasmid
#119138)
-
PurposeBase editor made from APOBEC3F
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119138 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneBE3
-
Backbone manufacturerLiu Lab
- Backbone size w/o insert (bp) 7825
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAPOBEC3F-Cas9 nickase-UGI
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1119
-
MutationNone
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer CGTGTACGGTGGGAGGTCTA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
A3F-Cas9n-UGI was a gift from Reuben Harris (Addgene plasmid # 119138 ; http://n2t.net/addgene:119138 ; RRID:Addgene_119138) -
For your References section:
A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes. Martin AS, Salamango DJ, Serebrenik AA, Shaban NM, Brown WL, Harris RS. Sci Rep. 2019 Jan 24;9(1):497. doi: 10.1038/s41598-018-36739-9. 10.1038/s41598-018-36739-9 PubMed 30679582