Skip to main content
Addgene

pCCLc-MND-B2705-KK10-SABR
(Plasmid #119053)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119053 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCCLc-MND
  • Backbone manufacturer
    Donald B. Kohn's laboratory at UCLA
  • Backbone size w/o insert (bp) 6600
  • Total vector size (bp) 9000
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    surface myc-tag

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    B2705-KK10-SABR
  • Promoter MND

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTCCCCGAGCTCAATAAAAG
  • 3′ sequencing primer TGGCTAAGATCTACAGCTGCCTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCCLc-MND-B2705-KK10-SABR was a gift from David Baltimore (Addgene plasmid # 119053 ; http://n2t.net/addgene:119053 ; RRID:Addgene_119053)
  • For your References section:

    T cell antigen discovery via signaling and antigen-presenting bifunctional receptors. Joglekar AV, Leonard MT, Jeppson JD, Swift M, Li G, Wong S, Peng S, Zaretsky JM, Heath JR, Ribas A, Bethune MT, Baltimore D. Nat Methods. 2019 Feb;16(2):191-198. doi: 10.1038/s41592-018-0304-8. Epub 2019 Jan 28. 10.1038/s41592-018-0304-8 PubMed 30700902