Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJKW1077
(Plasmid #119025)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119025 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHis8-4
  • Backbone size w/o insert (bp) 5336
  • Total vector size (bp) 6528
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PmCHS
  • Species
    Piper methysticum
  • Insert Size (bp)
    1185
  • GenBank ID
    MK058495
  • Promoter T7
  • Tag / Fusion Protein
    • 8xHis (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJKW1077 was a gift from Jing-Ke Weng (Addgene plasmid # 119025 ; http://n2t.net/addgene:119025 ; RRID:Addgene_119025)
  • For your References section:

    The biosynthetic origin of psychoactive kavalactones in kava. Pluskal T, Torrens-Spence MP, Fallon TR, De Abreu A, Shi CH, Weng JK. Nat Plants. 2019 Jul 22. pii: 10.1038/s41477-019-0474-0. doi: 10.1038/s41477-019-0474-0. 10.1038/s41477-019-0474-0 PubMed 31332312