pFGL1252_TetGFP(Hyg)
(Plasmid
#118993)
-
PurposeTetOFF controlled GFP-tagging vector with Hygromycin selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118993 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFGL125_TetOFF(Hyg)
-
Backbone manufacturerNaweed Lab
- Backbone size w/o insert (bp) 10687
- Total vector size (bp) 11398
-
Modifications to backboneTet OFF cassette fused with eGFP (no stop codon)
-
Vector typeFungal expression (in Magnaporthe oryzae)
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
-
Insert Size (bp)723
- Promoter Ustilago maydis Mfa1 basal promoter with six tetO binding sites
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nde I (destroyed during cloning)
- 3′ cloning site Kpn I (not destroyed)
- 5′ sequencing primer GGTCATATGGTGAGCAAGGGCGAGGAG
- 3′ sequencing primer TAGGGTACCCTTGTACAGCTCGTCCATGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFGL1252_TetGFP(Hyg) was a gift from Naweed Naqvi (Addgene plasmid # 118993 ; http://n2t.net/addgene:118993 ; RRID:Addgene_118993) -
For your References section:
Cellular Dynamics and Genomic Identity of Centromeres in Cereal Blast Fungus. Yadav V, Yang F, Reza MH, Liu S, Valent B, Sanyal K, Naqvi NI. MBio. 2019 Jul 30;10(4). pii: mBio.01581-19. doi: 10.1128/mBio.01581-19. 10.1128/mBio.01581-19 PubMed 31363034