pET-21a(+)-IPP1-His
(Plasmid #118978)

• Purpose: Bacterial expression plasmid for Inorganic pyrophosphatase
• Depositing Lab: Sebastian Maerkl
• Publication: Lavickova et al ACS Synth Biol. 2019 Jan 11. doi: 10.1021/acssynbio.8b00427.

Backbone

• Vector backbone: pET21a(+)
• Backbone manufacturer: EMD Biosciences
• Backbone size w/o insert (bp): 5443
• Total vector size (bp): 6099
• Modifications to backbone: Part of the original backbone, containing the T7 promoter, the RBS and the T7 terminator, was replaced by the insert.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: inorganic diphosphatase IPP1
• Alt name: Inorganic pyrophosphatase
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1376
• GenBank ID: NM_001178359.1
• Entrez Gene: IPP1 (a.k.a. YBR011C, PPA1)
• Promoter: T7 promoter
• Tag / Fusion Protein:
  • 6x-His (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCGTCCCATTCGCCAATCCG
• 3′ sequencing primer: GCGTCCGGCGTAGAGGATC

Resource Information

• Supplemental Documents:
  • pET-21a-IPP1-His.gb
• A portion of this plasmid was derived from a plasmid made by: The gene was originally cloned to vector pET29b by Yoshihiro Shimizu (RIKEN). (Shimizu, Yoshihiro, et al. "Cell-free translation reconstituted with purified components." Nature biotechnology 19.8 (2001): 751.)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/09/18/420570 for bioRxiv preprint.