pET-21a(+)-AK1-His
(Plasmid #118977)

• Purpose: Bacterial expression plasmid for Adenylate kinase isoenzyme 1
• Depositing Lab: Sebastian Maerkl
• Publication: Lavickova et al ACS Synth Biol. 2019 Jan 11. doi: 10.1021/acssynbio.8b00427.

Backbone

• Vector backbone: pET21a(+)
• Backbone manufacturer: EMD Biosciences
• Backbone size w/o insert (bp): 5443
• Total vector size (bp): 5953
• Modifications to backbone: Part of the original backbone, containing the T7 promoter, the RBS and the T7 terminator, was replaced by the insert.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: adenylate kinase isoenzyme 1 AK1
• Alt name: Myokinase
• Species: G. gallus (chicken)
• Insert Size (bp): 1097
• GenBank ID: NM_205109.2
• Entrez Gene: AK1
• Promoter: T7 promoter
• Tag / Fusion Protein:
  • 6x-His (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCGTCCCATTCGCCAATCCG
• 3′ sequencing primer: GCGTCCGGCGTAGAGGATC

Resource Information

• Supplemental Documents:
  • pET-21a-AK1-His.gb
• A portion of this plasmid was derived from a plasmid made by: Gene was originally clone to vector pET29b by Yoshihiro Shimizu, RIKEN Center for Biosystems Dynamics Research
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/09/18/420570 for bioRxiv preprint.