FRB_nSuMMVp
(Plasmid #118970)

• Purpose: Expresses N-terminus of sunflower mild mosaic virus protease (SuMMVp) fused to the FKBP-rapamycin binding (FRB) domain
• Depositing Lab: Roman Jerala
• Publication: Fink et al Nat Chem Biol. 2019 Feb;15(2):115-122. doi: 10.1038/s41589-018-0181-6. Epub 2018 Dec 10.

Backbone

• Vector backbone: pcDNA3
• Backbone size w/o insert (bp): 5443
• Total vector size (bp): 6184
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: split nSuMMVp in fusion with FRB
• Alt name: FRB_nSuMMVp
• Promoter: CMV
• Tag / Fusion Protein:
  • Myc tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • FRB_nSuMMVp.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry