Skip to main content
Addgene

MiniCoopR 2xU6:gRNA, mitfa:Cas9
(Plasmid #118844)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118844 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    MiniCoopR
  • Vector type
    CRISPR ; Tol2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Use the BseRI enzyme to clone gRNA of interest in the first U6:gRNA cassette. Use primer: CCATACCACATTTGTAGAGGT to sequence insert. Use the aaRI enzyme to clone gRNA of interest in the second U6:gRNA cassette. Use primer: GCTTACAACAAACACAGAGA to sequence insert.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MiniCoopR 2xU6:gRNA, mitfa:Cas9 was a gift from Leonard Zon (Addgene plasmid # 118844 ; http://n2t.net/addgene:118844 ; RRID:Addgene_118844)

  • For your References section:

    Human tumor genomics and zebrafish modeling identify SPRED1 loss as a driver of mucosal melanoma. Ablain J, Xu M, Rothschild H, Jordan RC, Mito JK, Daniels BH, Bell CF, Joseph NM, Wu H, Bastian BC, Zon LI, Yeh I. Science. 2018 Nov 1. pii: science.aau6509. doi: 10.1126/science.aau6509. 10.1126/science.aau6509 PubMed 30385465
Related items:
Commonly requested with: