Desmoplakin I tension sensor (F40-based)
(Plasmid #118725)

• Purpose: The F40-based human desmoplakin I tension sensor detects forces in the range of 1-6 pN by changes in FRET between YPet(short) and mCherry.
• Depositing Lab: Carsten Grashoff
• Publication: Price et al Nat Commun. 2018 Dec 11;9(1):5284. doi: 10.1038/s41467-018-07523-0.

Backbone

• Vector backbone: pLPCX
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6265
• Total vector size (bp): 16382
• Modifications to backbone: modified multiple cloning site
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: human Desmoplakin I-[YPet(short)-F40-mCherry] (internal-1952)
• Alt name: Desmoplakin I tension sensor (F40-based)
• Alt name: DPI-TS (YF40C)
• Species: H. sapiens (human)
• Insert Size (bp): 10149
• Mutation: inserted F40-based tension sensor module after aa1952
• GenBank ID: NM_004415.2
• Entrez Gene: DSP (a.k.a. DCWHKTA, DP)
• Promoter: CMV
• Tag / Fusion Protein:
  • YPet(short)-F40-mCherry

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ECoRI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: AGCTcGTTTAGTGAACCGTCAGATC
• 3′ sequencing primer: ACCTACAGGTGGGGTCTTTCATTCCC

Resource Information

• Supplemental Documents:
  • pLPCXmod + human Desmoplakin I-[YPet(short)-F40-mCherry] (internal-1952).gbk
• A portion of this plasmid was derived from a plasmid made by: Desmoplakin I-GFP (Addgene, #32227) from Kathleen Green and F40-based tension sensor module (Addgene, #101252) from Carsten Grashoff
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry