Skip to main content
Addgene

Desmoplakin II donor only control (FL-based no force control)
(Plasmid #118722)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118722 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLPCX
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6265
  • Total vector size (bp) 11957
  • Modifications to backbone
    modified multiple cloning site
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    human Desmoplakin II (1-1353)-[YPet(short)-FL-mCherry(Y72L)]
  • Alt name
    Desmoplakin II donor only control for FL-based no force control
  • Alt name
    DPII-tr (YFLdC)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5715
  • Mutation
    truncation after aa1353; Y72L mutation in mCherry to disrupt chromophore formation
  • GenBank ID
    NM_001008844.1
  • Entrez Gene
    DSP (a.k.a. DCWHKTA, DP)
  • Promoter CMV
  • Tag / Fusion Protein
    • YPet(short)-FL-mCherry(Y72L) (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ cloning site ECoRI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer AGCTcGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Desmoplakin I-GFP (Addgene, #32227) from Kathleen Green used as a template for Desmoplakin II and FL-based tension sensor module (Addgene, #101170) from Carsten Grashoff

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Desmoplakin II donor only control (FL-based no force control) was a gift from Carsten Grashoff (Addgene plasmid # 118722 ; http://n2t.net/addgene:118722 ; RRID:Addgene_118722)
  • For your References section:

    Mechanical loading of desmosomes depends on the magnitude and orientation of external stress. Price AJ, Cost AL, Ungewiss H, Waschke J, Dunn AR, Grashoff C. Nat Commun. 2018 Dec 11;9(1):5284. doi: 10.1038/s41467-018-07523-0. 10.1038/s41467-018-07523-0 PubMed 30538252