Desmoplakin II-YPet(short)
(Plasmid #118714)

• Purpose: The human desmoplakin II is C-terminally tagged with YPet(short) to serve as wild type control.
• Depositing Lab: Carsten Grashoff
• Publication: Price et al Nat Commun. 2018 Dec 11;9(1):5284. doi: 10.1038/s41467-018-07523-0.

Backbone

• Vector backbone: pLPCX
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6265
• Total vector size (bp): 13742
• Modifications to backbone: modified multiple cloning site
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Desmoplakin II-YPet(short)
• Alt name: Desmoplakin isoform II
• Alt name: DPII-wt
• Species: H. sapiens (human)
• Insert Size (bp): 7512
• GenBank ID: NM_001008844.1
• Entrez Gene: DSP (a.k.a. DCWHKTA, DP)
• Promoter: CMV
• Tag / Fusion Protein:
  • YPet(short) (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ECoRI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: AGCTcGTTTAGTGAACCGTCAGATC
• 3′ sequencing primer: ACCTACAGGTGGGGTCTTTCATTCCC

Resource Information

• Supplemental Documents:
  • pLPCXmod + human Desmoplakin II-YPet(short).gbk
• A portion of this plasmid was derived from a plasmid made by: Desmoplakin I-GFP (Addgene, #32227) from Kathleen Green used as a template for Desmoplakin II

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry