Skip to main content
Addgene

pSP2-48-merTetO-EFS-BLaR
(Plasmid #118712)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118712 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSP2
  • Total vector size (bp) 6837
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Blasticidin resistance gene
  • Insert Size (bp)
    880

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BstBI (not destroyed)
  • 5′ sequencing primer TAGAGAGTATAGAGGGTCC
  • 3′ sequencing primer CTTAAGCTAGCAGCGCTCTCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    EFS-NS promoter
  • Insert Size (bp)
    278
  • Promoter EFS-NS

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TAGAGAGTATAGAGGGTCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    48-mer TetO sequence was cloned by Gabriela Sustackova (laboratory of Prof. Andrew Belmont)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSP2-48-merTetO-EFS-BLaR was a gift from Huimin Zhao (Addgene plasmid # 118712 ; http://n2t.net/addgene:118712 ; RRID:Addgene_118712)
  • For your References section:

    CRISPR/Cas9-mediated knock-in of an optimized TetO repeat for live cell imaging of endogenous loci. Tasan I, Sustackova G, Zhang L, Kim J, Sivaguru M, HamediRad M, Wang Y, Genova J, Ma J, Belmont AS, Zhao H. Nucleic Acids Res. 2018 Jun 15. pii: 5038283. doi: 10.1093/nar/gky501. 10.1093/nar/gky501 PubMed 29912475