pDONR223-SLC7A11 sh926R
(Plasmid
#118701)
-
Purposeentry clone for SLC7A11 insensitive to hairpin TRCN0000288926
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118701 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDNR223
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSLC7A11
-
SpeciesH. sapiens (human)
-
Mutationwt , SLC7A11 sh926R
Cloning Information
- Cloning method Gateway Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pDONR223 SLC7A11 insensitive to hairpin TRCN0000288926 (target sequence: CCCTGGAGTTATGCAGCTAAT). Mutated cDNA sequence (GCCCGGCGTGATGCAATTGAT) was confirmed by DNA sequencing,
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDONR223-SLC7A11 sh926R was a gift from William Kaelin (Addgene plasmid # 118701 ; http://n2t.net/addgene:118701 ; RRID:Addgene_118701) -
For your References section:
Paracrine Induction of HIF by Glutamate in Breast Cancer: EglN1 Senses Cysteine. Briggs KJ, Koivunen P, Cao S, Backus KM, Olenchock BA, Patel H, Zhang Q, Signoretti S, Gerfen GJ, Richardson AL, Witkiewicz AK, Cravatt BF, Clardy J, Kaelin WG Jr. Cell. 2016 Jun 30;166(1):126-39. doi: 10.1016/j.cell.2016.05.042. 10.1016/j.cell.2016.05.042 PubMed 27368101