Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

C-Ag20(0)
(Plasmid #11866)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 11866 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTrcHis2
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4406
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Agrn
  • Alt name
    Agrin
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    528
  • GenBank ID
    NM_021604
  • Entrez Gene
    Agrn (a.k.a. Agrin, nmf380)
  • Tags / Fusion Proteins
    • myc (C terminal on backbone)
    • His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGAGGTATATATTAATGTATCG
  • 3′ sequencing primer N/A
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Hilgenberg, L. G., Su, H., Gu, H., O'Dowd D, K. & Smith, M. A. (2006) alpha3Na+/K+-ATPase Is a neuronal receptor for agrin. Cell 125, 359-69.

Note: Addgene found several mismatches in its sequence compared with the provided insert sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    C-Ag20(0) was a gift from Martin Smith (Addgene plasmid # 11866 ; http://n2t.net/addgene:11866 ; RRID:Addgene_11866)
  • For your References section:

    The COOH-terminal domain of agrin signals via a synaptic receptor in central nervous system neurons. Hoover CL, Hilgenberg LG, Smith MA. J Cell Biol. 2003 Jun 9. 161(5):923-32. 10.1083/jcb.200301013 PubMed 12796478