C-Ag20(0)
(Plasmid
#11866)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 11866 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTrcHis2
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4406
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAgrn
-
Alt nameAgrin
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)528
-
GenBank IDNM_021604
-
Entrez GeneAgrn (a.k.a. Agrin, nmf380)
-
Tags
/ Fusion Proteins
- myc (C terminal on backbone)
- His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AGAGGTATATATTAATGTATCG
- 3′ sequencing primer N/A (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Hilgenberg, L. G., Su, H., Gu, H., O'Dowd D, K. & Smith, M. A. (2006) alpha3Na+/K+-ATPase Is a neuronal receptor for agrin. Cell 125, 359-69.
Note: Addgene found several mismatches in its sequence compared with the provided insert sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
C-Ag20(0) was a gift from Martin Smith (Addgene plasmid # 11866 ; http://n2t.net/addgene:11866 ; RRID:Addgene_11866) -
For your References section:
The COOH-terminal domain of agrin signals via a synaptic receptor in central nervous system neurons. Hoover CL, Hilgenberg LG, Smith MA. J Cell Biol. 2003 Jun 9. 161(5):923-32. 10.1083/jcb.200301013 PubMed 12796478