Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAC1804_pmax-dCasRx-RBM38
(Plasmid #118638)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118638 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMAX
  • Backbone manufacturer
    Amaxa
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCasRx-RBM38
  • Species
    Synthetic
  • Promoter CAGGS

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gggcttgtcgagacagagaagat
  • 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    dCasRx coding sequence from Konermann et al (doi:10.1016/j.cell.2018.02.033) XR002: EF1a-dCasRx-2A-EGFP (Plasmid #109050); Effector sequence cloned using IDT gBlock as template

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

More info at http://CasFx.org . Please visit https://www.biorxiv.org/content/early/2018/09/30/431064 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC1804_pmax-dCasRx-RBM38 was a gift from Albert Cheng (Addgene plasmid # 118638 ; http://n2t.net/addgene:118638 ; RRID:Addgene_118638)
  • For your References section:

    CRISPR artificial splicing factors. Du M, Jillette N, Zhu JJ, Li S, Cheng AW. Nat Commun. 2020 Jun 12;11(1):2973. doi: 10.1038/s41467-020-16806-4. 10.1038/s41467-020-16806-4 PubMed 32532987