Dead-Laconic/pcDNA3.1(-)
(Plasmid #118627)

• Purpose: To express in mammalian cells a lactate FRET sensor negative control.
• Depositing Lab: Luis Felipe Barros
• Publication: Baeza-Lehnert et al Methods Mol Biol. 2020;2184:19-30. doi: 10.1007/978-1-0716-0802-9_2.

Backbone

• Vector backbone: pcDNA3.1(-)
• Backbone manufacturer: ThermoFisher Scientific
• Backbone size w/o insert (bp): 5419
• Total vector size (bp): 7648
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Dead-Laconic
• Species: Synthetic
• Insert Size (bp): 2229
• Mutation: Change Histidine 151 to Aspartic Acid of Escherichia coli LldR
• Promoter: CMV Promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry