Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Dead-Laconic/pcDNA3.1(-)
(Plasmid #118627)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118627 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1(-)
  • Backbone manufacturer
    ThermoFisher Scientific
  • Backbone size w/o insert (bp) 5419
  • Total vector size (bp) 7648
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dead-Laconic
  • Species
    Synthetic
  • Insert Size (bp)
    2229
  • Mutation
    Change Histidine 151 to Aspartic Acid of Escherichia coli LldR
  • Promoter CMV Promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Dead-Laconic/pcDNA3.1(-) was a gift from Luis Felipe Barros (Addgene plasmid # 118627 ; http://n2t.net/addgene:118627 ; RRID:Addgene_118627)
  • For your References section:

    Monitoring Lactate Dynamics in Individual Macrophages with a Genetically Encoded Probe. Baeza-Lehnert F, Flores CA, Guequen A, Barros LF. Methods Mol Biol. 2020;2184:19-30. doi: 10.1007/978-1-0716-0802-9_2. 10.1007/978-1-0716-0802-9_2 PubMed 32808215