Skip to main content
Addgene

V5-ERG-R367K
(Plasmid #118624)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118624 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    N106
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ERG (R367K DNA binding mutant)
  • Species
    H. sapiens (human)
  • Mutation
    R367K
  • GenBank ID
    NP_891548.1
  • Entrez Gene
    ERG (a.k.a. LMPHM14, erg-3, p55)
  • Promoter EF1a
  • Tag / Fusion Protein
    • V5 (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ggcacttgatgtaattctccttg
  • 3′ sequencing primer gtggatgtggaatgtgtgcga
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

V5 tagged TMPRSS2-ERG R367K (aa33-479) with 2aa linker between V5 and ERG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    V5-ERG-R367K was a gift from William Hahn (Addgene plasmid # 118624 ; http://n2t.net/addgene:118624 ; RRID:Addgene_118624)

  • For your References section:

    Binding of TMPRSS2-ERG to BAF Chromatin Remodeling Complexes Mediates Prostate Oncogenesis. Sandoval GJ, Pulice JL, Pakula H, Schenone M, Takeda DY, Pop M, Boulay G, Williamson KE, McBride MJ, Pan J, St Pierre R, Hartman E, Garraway LA, Carr SA, Rivera MN, Li Z, Ronco L, Hahn WC, Kadoch C. Mol Cell. 2018 Aug 16;71(4):554-566.e7. doi: 10.1016/j.molcel.2018.06.040. Epub 2018 Aug 2. 10.1016/j.molcel.2018.06.040 PubMed 30078722
Related items:
Commonly requested with: