pMCh2008_pLenti_Syn_mChe-cdc42E7-E63'UTR
(Plasmid #118622)

• Purpose: expression of mChe-tagged cdc42E7-E6-3'UTR under pSyn promoter for primary neurons
• Depositing Lab: Marina Chekulaeva
• Publication: Ciolli Mattioli et al Nucleic Acids Res. 2018 Dec 22. pii: 5258023. doi: 10.1093/nar/gky1270.

Backbone

• Vector backbone: pLenti.Syn(0.5).H2B-eGFP.W
• Backbone size w/o insert (bp): 7846
• Total vector size (bp): 10151
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Bleomycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: cdc42E7-E6 3'UTR
• Species: M. musculus (mouse)
• Insert Size (bp): 1344
• Mutation: changed ttgcttt to cggtaag (496 - 502 nt in 3'UTR) for shRNA resistance
• GenBank ID: NM_009861 NM_001243769
• Entrez Gene: Cdc42
• Promoter: synapsin I (rat)
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCACCACAAGAGGTGCAAGATAG
• 3′ sequencing primer: CAGGGAAGTAGCCTTGTGTGTG

Resource Information

• Supplemental Documents:
  • pMCh2008_pLenti_Syn_mChe-cdc42E7-E63'UTR

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry