pET22b-ecDHFR-G51PEKN
(Plasmid #118582)

• Purpose: Bacterial expression of E.coli DHFR G51PEKN mutant
• Depositing Lab: Stephen Benkovic
• Publication: Liu et al Proc Natl Acad Sci U S A. 2013 Jun 18;110(25):10159-64. doi: 10.1073/pnas.1307130110. Epub 2013 Jun 3.

Backbone

• Vector backbone: pET22b
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5493
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: DHFR
• Alt name: dihydrofolate reductase
• Alt name: folA
• Species: E.coli
• Insert Size (bp): 489
• Mutation: G51 mutated to P51; Glu-Lys-Asn residues inserted between residues 51 and 52 of wild-type ecDHF
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry