Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET22b-ecDHFR-G51PEKN
(Plasmid #118582)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118582 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET22b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5493
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DHFR
  • Alt name
    dihydrofolate reductase
  • Alt name
    folA
  • Species
    E.coli
  • Insert Size (bp)
    489
  • Mutation
    G51 mutated to P51; Glu-Lys-Asn residues inserted between residues 51 and 52 of wild-type ecDHF
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET22b-ecDHFR-G51PEKN was a gift from Stephen Benkovic (Addgene plasmid # 118582 ; http://n2t.net/addgene:118582 ; RRID:Addgene_118582)
  • For your References section:

    Functional significance of evolving protein sequence in dihydrofolate reductase from bacteria to humans. Liu CT, Hanoian P, French JB, Pringle TH, Hammes-Schiffer S, Benkovic SJ. Proc Natl Acad Sci U S A. 2013 Jun 18;110(25):10159-64. doi: 10.1073/pnas.1307130110. Epub 2013 Jun 3. 10.1073/pnas.1307130110 PubMed 23733948