pLEX307 GFP-Kif26b-C
(Plasmid #118483)

• Purpose: lentiviral expression of GFP-Kif26b-C in mammalian cells
• Depositing Lab: Henry Ho
• Publication: Karuna et al Genes (Basel). 2018 Apr 5;9(4). pii: genes9040196. doi: 10.3390/genes9040196.

Backbone

• Vector backbone: pLEX_307
• Backbone manufacturer: Addgene #41392 (provided by David Root)
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mouse Kif26b-C
• Alt name: Kif26b WRD domain (Wnt5a regulated degradation domain)
• Species: M. musculus (mouse)
• Insert Size (bp): 1140
• Mutation: Encodes GFP fused to amino acid 1735 to 2112 of mouse Kif26b
• GenBank ID: NP_001155137.1
• Entrez Gene: Kif26b (a.k.a. 4832420M10, BC056349, D230039L06Rik)
• Promoter: EF1A
• Tag / Fusion Protein:
  • GFP

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: EF1A promoter forward (TCAAGCCTCAGACAGTGGTTC)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry