Skip to main content
Addgene

pCS2+ AMIC
(Plasmid #118420)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118420 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCS2+
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Amoeba myosin 1C
  • Species
    Acanthamoeba castellanii
  • Insert Size (bp)
    3562
  • Mutation
    See depositor comments below

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nco1 (unknown if destroyed)
  • 3′ cloning site Xba1 (unknown if destroyed)
  • 5′ sequencing primer cggtcaacccctacaaacaaatcaac
  • 3′ sequencing primer ttacatgccggggggaggaggacc
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Plasmid contains a F382I mutation, a G1072-K1073 deletion, and a S1074A mutation in AMIC compared to the NCBI reference sequence AAC98089.1. These differences are not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2+ AMIC was a gift from Michael Tsang (Addgene plasmid # 118420 ; http://n2t.net/addgene:118420 ; RRID:Addgene_118420)

  • For your References section:

    Vertebrate myosin 1d regulates left-right organizer morphogenesis and laterality. Saydmohammed M, Yagi H, Calderon M, Clark MJ, Feinstein T, Sun M, Stolz DB, Watkins SC, Amack JD, Lo CW, Tsang M. Nat Commun. 2018 Aug 23;9(1):3381. doi: 10.1038/s41467-018-05866-2. 10.1038/s41467-018-05866-2 PubMed 30139971
Related items: