Skip to main content
Addgene

LentiCRISPRv2-sgSORCS2-G2
(Plasmid #118416)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118416 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang, Addgene plasmid #52961
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA SORCS2 Human
  • gRNA/shRNA sequence
    GCCGCGGCACCCGGGTCAGTT
  • Species
    H. sapiens (human)
  • Entrez Gene
    SORCS2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPRv2-sgSORCS2-G2 was a gift from Mark Denham (Addgene plasmid # 118416 ; http://n2t.net/addgene:118416 ; RRID:Addgene_118416)

  • For your References section:

    A Modified Monomeric Red Fluorescent Protein Reporter for Assessing CRISPR Activity. Hojland Knudsen C, Asgrimsdottir ES, Rahimi K, Gill KP, Frandsen S, Hvolbol Buchholdt S, Chen M, Kjems J, Febbraro F, Denham M. Front Cell Dev Biol. 2018 May 15;6:54. doi: 10.3389/fcell.2018.00054. eCollection 2018. 10.3389/fcell.2018.00054 PubMed 29868584
Related items:
Commonly requested with: