pLenti-X1-hygro-mCherry-RAMP4
(Plasmid #118391)

• Purpose: stable lentiviral expression of cDNA
• Depositing Lab: Jacob Corn
• Publication: Liang et al J Cell Biol. 2018 Aug 24. pii: jcb.201804185. doi: 10.1083/jcb.201804185.

Backbone

• Vector backbone: pLenti-X1-hygro
• Backbone manufacturer: Michael Rape
• Backbone size w/o insert (bp): 9005
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Hygromycin ; mCherry

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RAMP4
• Alt name: SERP1
• Species: H. sapiens (human)
• Insert Size (bp): 933
• Entrez Gene: SERP1
• Promoter: EIF-1a promoter
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: AGCCTCAGACAGTGGTTCAA
• 3′ sequencing primer: agcagcgtatccacatagcgt

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

5' cloning site: BamHI (not destroyed), 3' cloning site: XbaI (not destroyed)