-
PurposeEntry clone containing ccdB negative selection marker. Used to clone any DNA fragments of interest; goldengate and gibson assembly cloning compatible. For use in plants and compatible with the MultiSite Gateway system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118389 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDONR-P2R-P3z
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameccdB
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer M13 Forward (-20) gtaaaacgacggccag
- 3′ sequencing primer T7 universal primer, taatacgactcactataggg (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p2R3z-BASI-ccdB-BSAI was a gift from Ari Pekka Mähönen (Addgene plasmid # 118389 ; http://n2t.net/addgene:118389 ; RRID:Addgene_118389) -
For your References section:
An inducible genome editing system for plants. Wang X, Ye L, Lyu M, Ursache R, Loytynoja A, Mahonen AP. Nat Plants. 2020 Jun 29. pii: 10.1038/s41477-020-0695-2. doi: 10.1038/s41477-020-0695-2. 10.1038/s41477-020-0695-2 PubMed 32601420