KAT14-pDEST10
(Plasmid
#118382)
-
PurposeHIS-tagged insect cell expression vector with KAT14.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118382 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDEST10
-
Backbone manufacturerThermo Fisher Scientific
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKAT14
-
Alt nameCSRP2BP
-
Alt nameATAC2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2349
-
Entrez GeneKAT14 (a.k.a. ATAC2, CRP2BP, CSRP2BP, PRO1194, dJ717M23.1)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- HIS (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GGATTATTCATACCGTCCCA
- 3′ sequencing primer CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/445973v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
KAT14-pDEST10 was a gift from Maria Vartiainen (Addgene plasmid # 118382 ; http://n2t.net/addgene:118382 ; RRID:Addgene_118382) -
For your References section:
Nuclear actin interactome analysis links actin to KAT14 histone acetyl transferase and mRNA splicing. Viita T, Kyheroinen S, Prajapati B, Virtanen J, Frilander MJ, Varjosalo M, Vartiainen MK. J Cell Sci. 2019 Apr 17;132(8). pii: jcs.226852. doi: 10.1242/jcs.226852. 10.1242/jcs.226852 PubMed 30890647