mCherry-Rap2b
(Plasmid
#118320)
-
PurposeExpression of human Rap2b
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118320 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonemCherry-C1
-
Backbone manufacturerclontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRap2b
-
SpeciesH. sapiens (human)
-
Insert Size (bp)555
-
Entrez GeneRAP2B
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer mCherry-C:gcgcctacaacgtcaacatcaag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
human Rap2b was purchased from the Missouri S&T cDNA resouce center
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-Rap2b was a gift from Philip Stork (Addgene plasmid # 118320 ; http://n2t.net/addgene:118320 ; RRID:Addgene_118320) -
For your References section:
The interaction of Epac1 and Ran promotes Rap1 activation at the nuclear envelope. Liu C, Takahashi M, Li Y, Dillon TJ, Kaech S, Stork PJ. Mol Cell Biol. 2010 Aug;30(16):3956-69. doi: 10.1128/MCB.00242-10. Epub 2010 Jun 14. 10.1128/MCB.00242-10 PubMed 20547757