pAAV-DCX-2A-mCherry
(Plasmid #118290)

• Purpose: Expresses human DCX tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells.
• Depositing Lab: Vance Lemmon
• Publication: Slepak et al Cytoskeleton (Hoboken). 2012 Jul;69(7):514-27. doi: 10.1002/cm.21021. Epub 2012 Mar 7.

Backbone

• Vector backbone: pAAV-2A-mCherry
• Backbone size w/o insert (bp): 5429
• Total vector size (bp): 6509
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: doublecortin
• Alt name: DCX
• Species: H. sapiens (human)
• Insert Size (bp): 1080
• GenBank ID: NM_178151.2
• Entrez Gene: DCX (a.k.a. DBCN, DC, LISX, SCLH, XLIS)
• Promoter: CMV with beta global intron
• Tags / Fusion Proteins:
  • 2A peptide (C terminal on insert)
  • mCherry (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PCR insert with BglII, ligated to BamHI on the vector (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GGCAAAGAATTGGGATTCGA
• 3′ sequencing primer: TTCAGCTTGGCGGTCTGGGT

Resource Information

• Supplemental Documents:
  • pAAV-DCX-2A-mCherry.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry