pAAV-DYRK4-2A-GFP
(Plasmid
#118288)
-
PurposeExpresses mouse DYRK4 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118288 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-2A-EGFP
- Backbone size w/o insert (bp) 5414
- Total vector size (bp) 7196
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
-
Alt nameDYRK4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1782
-
GenBank IDBC052324.1 XM_006505256.3
-
Entrez GeneDyrk4 (a.k.a. AW049118, Dyrk4a, Dyrk4b)
- Promoter CMV with beta global intron
-
Tags
/ Fusion Proteins
- 2A peptide (C terminal on insert)
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer tggttgggataaggctggat
- 3′ sequencing primer aacttgtggccgtttacgtc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-DYRK4-2A-GFP was a gift from Vance Lemmon (Addgene plasmid # 118288 ; http://n2t.net/addgene:118288 ; RRID:Addgene_118288) -
For your References section:
Dyrk kinases regulate phosphorylation of doublecortin, cytoskeletal organization, and neuronal morphology. Slepak TI, Salay LD, Lemmon VP, Bixby JL. Cytoskeleton (Hoboken). 2012 Jul;69(7):514-27. doi: 10.1002/cm.21021. Epub 2012 Mar 7. 10.1002/cm.21021 PubMed 22359282