pAAV-DYRK2-2A-GFP
(Plasmid #118284)

• Purpose: Expresses mouse DYRK2 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.
• Depositing Lab: Vance Lemmon
• Publication: Slepak et al Cytoskeleton (Hoboken). 2012 Jul;69(7):514-27. doi: 10.1002/cm.21021. Epub 2012 Mar 7.

Backbone

• Vector backbone: pAAV-2A-GFP
• Backbone size w/o insert (bp): 5418
• Total vector size (bp): 7215
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
• Alt name: DYRK2
• Species: M. musculus (mouse)
• Insert Size (bp): 1797
• GenBank ID: BC085145.1 NM_001014390.2
• Entrez Gene: Dyrk2 (a.k.a. 1810038L18Rik)
• Promoter: CMV with beta global intron
• Tags / Fusion Proteins:
  • 2A peptide (C terminal on insert)
  • GFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (not destroyed)
• 3′ cloning site: SalI to XhoI (destroyed during cloning)
• 5′ sequencing primer: tggttgggataaggctggat
• 3′ sequencing primer: GFP reverse

Resource Information

• Supplemental Documents:
  • pAAV-mDYRK2-2A-eGFP_SEQ.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry