pJS101
(Plasmid
#118280)
-
PurposeExpresses GFPmut2 with low cell-to-cell variation on a low-copy plasmid and tetracycline induction
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepGB2
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGFPmut2
- Promoter pLtetO-1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcttacccgtcttactgtcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJS101 was a gift from Zach Hensel (Addgene plasmid # 118280 ; http://n2t.net/addgene:118280 ; RRID:Addgene_118280) -
For your References section:
Plasmids for Independently Tunable, Low-Noise Expression of Two Genes. Silva JPN, Lopes SV, Grilo DJ, Hensel Z. mSphere. 2019 May 29;4(3). pii: 4/3/e00340-19. doi: 10.1128/mSphere.00340-19. 10.1128/mSphere.00340-19 PubMed 31142623
