pAAV-camk2-Sthk-p2a-bpac(WT) minWPRE
(Plasmid #118274)

• Purpose: Expresses the SthK channel & bPAC(WT)-mCherry under a minimal CamKII promoter
• Depositing Lab: Dietmar Schmitz
• Publication: Bernal Sierra et al Nat Commun. 2018 Nov 5;9(1):4611. doi: 10.1038/s41467-018-07038-8.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: CW3SL
• Backbone manufacturer: Bong-Kiun Kaang
• Backbone size w/o insert (bp): 3771
• Total vector size (bp): 7002
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: bPAC(WT)
• Alt name: photoactivated adenylyl cyclase from Beggiatoa sp.
• Species: Beggiatoa sp.
• Insert Size (bp): 1055
• GenBank ID:
• Promoter: CamK II
• Tags / Fusion Proteins:
  • myc tag (C terminal on insert)
  • His tag (C terminal on insert)
  • mCherry (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGGAGCTACTAACTTCAGCC
• 3′ sequencing primer: CGTATCCACATAGCGTAAAAGGAGCAA

Gene/Insert 2

• Gene/Insert name: SthK
• Species: Spirochaeta thermophila
• GenBank ID: YP_003873862.1
• Promoter: CamK II
• Tag / Fusion Protein:
  • P2A (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTCTCCGTTTGCACTCAGGA
• 3′ sequencing primer: GGGTTCTCCTCCACGTCTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry