Skip to main content
Addgene

pAAV-camk2-Sthk-p2a-bpac(WT) minWPRE
(Plasmid #118274)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118274 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    CW3SL
  • Backbone manufacturer
    Bong-Kiun Kaang
  • Backbone size w/o insert (bp) 3771
  • Total vector size (bp) 7002
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    bPAC(WT)
  • Alt name
    photoactivated adenylyl cyclase from Beggiatoa sp.
  • Species
    Beggiatoa sp.
  • Insert Size (bp)
    1055
  • GenBank ID
  • Promoter CamK II
  • Tags / Fusion Proteins
    • myc tag (C terminal on insert)
    • His tag (C terminal on insert)
    • mCherry (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGGAGCTACTAACTTCAGCC
  • 3′ sequencing primer CGTATCCACATAGCGTAAAAGGAGCAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    SthK
  • Species
    Spirochaeta thermophila
  • GenBank ID
    YP_003873862.1
  • Promoter CamK II
  • Tag / Fusion Protein
    • P2A (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTTCTCCGTTTGCACTCAGGA
  • 3′ sequencing primer GGGTTCTCCTCCACGTCTC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-camk2-Sthk-p2a-bpac(WT) minWPRE was a gift from Dietmar Schmitz (Addgene plasmid # 118274 ; http://n2t.net/addgene:118274 ; RRID:Addgene_118274)
  • For your References section:

    Potassium channel-based optogenetic silencing. Bernal Sierra YA, Rost BR, Pofahl M, Fernandes AM, Kopton RA, Moser S, Holtkamp D, Masala N, Beed P, Tukker JJ, Oldani S, Bonigk W, Kohl P, Baier H, Schneider-Warme F, Hegemann P, Beck H, Seifert R, Schmitz D. Nat Commun. 2018 Nov 5;9(1):4611. doi: 10.1038/s41467-018-07038-8. 10.1038/s41467-018-07038-8 PubMed 30397200