pAAV-DYRK1A-2A-mCherry
(Plasmid #118272)

• Purpose: Expresses mouse DYRK1A tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells.
• Depositing Lab: Vance Lemmon
• Publication: Slepak et al Cytoskeleton (Hoboken). 2012 Jul;69(7):514-27. doi: 10.1002/cm.21021. Epub 2012 Mar 7.

Backbone

• Vector backbone: pAAV-2A-mCherry
• Backbone size w/o insert (bp): 5394
• Total vector size (bp): 7656
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a
• Alt name: DYRK1A
• Species: M. musculus (mouse)
• Insert Size (bp): 2262
• GenBank ID: NM_001347731.1
• Entrez Gene: Dyrk1a (a.k.a. 2310043O08Rik, D16Ertd272e, D16Ertd493e, Dyrk, Gm10783, Mnbh, Mp86, mmb)
• Promoter: CMV with beta global intron
• Tags / Fusion Proteins:
  • 2A peptide (C terminal on insert)
  • mCherry (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: tggttgggataaggctggat
• 3′ sequencing primer: GFP reverse

Resource Information

• Supplemental Documents:
  • pAAV-mDYRK1A-2A-mCherry_SEQ.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry