N295A (EcN), E166Q (EcN) MetNI LmH
(Plasmid #118269)

• Purpose: N295A and E166Q Mutation of MetN in Methionine ABC Transporter with 6x His Tag. Used to solve crystal structure
• Depositing Lab: Douglas Rees
• Publication: Nguyen et al Proc Natl Acad Sci U S A. 2018 Oct 23. pii: 1811003115. doi: 10.1073/pnas.1811003115.

Backbone

• Vector backbone: pET19b
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5453
• Total vector size (bp): 7426
• Modifications to backbone: Addd extra T7 Promoter, T7 Terminator, and 6x His Tag with the addition of MetN gene.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: MetI
• Species: Escherichia coli
• Insert Size (bp): 654
• GenBank ID: 944894
• Entrez Gene: metI (a.k.a. b0198, ECK0198, JW0194, metD, yaeE)
• Promoter: T7 Promoter
• Tag / Fusion Protein:
  • 6x His Tag

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: ccgatcccgcgaaattaatacgactcactataggggaatt
• 3′ sequencing primer: gtggaacactttggtgatattcgaaagttttatcatatga

Gene/Insert 2

• Gene/Insert name: MetN (E166Q ; N295A)
• Species: Escherichia coli
• Insert Size (bp): 1032
• Mutation: Changed Glutamic Acid (Glu) 166 to Glutamine (Gln) and Changed Asparagine (Asn) 295 to Alanine (Ala)
• GenBank ID: 944896
• Entrez Gene: metN (a.k.a. b0199, ECK0199, JW0195, abc, metD)
• Promoter: T7 Promoter
• Tag / Fusion Protein:
  • 6x His Tag (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: tttaattcagttcgcaggcgaccgcatcg
• 3′ sequencing primer: ctcgagtcagacataacccagtacctcta

Resource Information

• Supplemental Documents:
  • e166q-n295a-lmh-metni-in-pet19b.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry