Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

WT MetNI in pBAD
(Plasmid #118254)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118254 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBAD
  • Backbone manufacturer
    Thermo Scientific Invitrogen
  • Backbone size w/o insert (bp) 3966
  • Total vector size (bp) 5713
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    MetN
  • Species
    Escherichia coli
  • Insert Size (bp)
    1032
  • GenBank ID
    944896
  • Entrez Gene
    metN (a.k.a. b0199, ECK0199, JW0195, abc, metD)
  • Promoter Arabinose Promoter
  • Tags / Fusion Proteins
    • 10x His Tag (N terminal on insert)
    • Enterokinase Cleavage Site (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer pBAD Forward
  • 3′ sequencing primer ttagcaataatttgccccggacgcgtgacata
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    MetI
  • Species
    Escherichia coli
  • Insert Size (bp)
    654
  • GenBank ID
    944894
  • Entrez Gene
    metI (a.k.a. b0198, ECK0198, JW0194, metD, yaeE)
  • Promoter None

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer tagcgcgcagatggattacgccggtggcgttaagttcggc
  • 3′ sequencing primer pBAD Reverse
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    WT MetNI in pBAD was a gift from Douglas Rees (Addgene plasmid # 118254 ; http://n2t.net/addgene:118254 ; RRID:Addgene_118254)
  • For your References section:

    Noncanonical role for the binding protein in substrate uptake by the MetNI methionine ATP Binding Cassette (ABC) transporter. Nguyen PT, Lai JY, Lee AT, Kaiser JT, Rees DC. Proc Natl Acad Sci U S A. 2018 Oct 23. pii: 1811003115. doi: 10.1073/pnas.1811003115. 10.1073/pnas.1811003115 PubMed 30352853