3xHA-BioID_pAS28
(Plasmid #118223)

• Purpose: expresses 3xHA-tagged BioID in C. elegans intestine
• Depositing Lab: Jessica Feldman
• Publication: Branon et al Nat Biotechnol. 2018 Aug 20. pii: nbt.4201. doi: 10.1038/nbt.4201.

Backbone

• Vector backbone: Bluescript
• Backbone size w/o insert (bp): 6954
• Total vector size (bp): 8151
• Modifications to backbone: The backbone contains a gut promoter and unc-54 UTR for worm intestine expression of BioID.
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BioID (BirA mutant)
• Species: C. elegans (nematode)
• Insert Size (bp): 1110
• Mutation: R118G
• Promoter: ges-1p
• Tag / Fusion Protein:
  • 3x HA tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: FseI (unknown if destroyed)
• 3′ cloning site: XmaI (unknown if destroyed)
• 5′ sequencing primer: aagaacgtgatcgcagctctac
• 3′ sequencing primer: cacaatttcattgttagaggtgactt

Resource Information

• Supplemental Documents:
  • pAS28_ges-1p--BirA(R118G)--unc54UTR copy (1).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry