3xHA-TurboID_pAS31
(Plasmid #118220)

• Purpose: expresses 3xHA-tagged TurboID in C. elegans intestine
• Depositing Lab: Jessica Feldman
• Publication: Branon et al Nat Biotechnol. 2018 Aug 20. pii: nbt.4201. doi: 10.1038/nbt.4201.

Backbone

• Vector backbone: Bluescript
• Backbone size w/o insert (bp): 6957
• Total vector size (bp): 8151
• Modifications to backbone: The backbone contains a gut promoter and unc-54 UTR for worm intestine expression of TurboID.
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TurboID (BirA mutant)
• Species: C. elegans (nematode)
• Insert Size (bp): 1110
• Mutation: Q65P, I87V, R118S, E140K, Q141R, S150G, L151P, V160A, T192A, K194I, M209V, M241T, S263P, I305V
• Promoter: ges-1p
• Tag / Fusion Protein:
  • 3x HA tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: FseI (unknown if destroyed)
• 3′ cloning site: XmaI (unknown if destroyed)
• 5′ sequencing primer: aagaacgtgatcgcagctctac
• 3′ sequencing primer: cacaatttcattgttagaggtgactt

Resource Information

• Supplemental Documents:
  • pAS31_ges-1p--TurboID--unc54UTR (1).gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please see depositor's annotated sequence in the Supplemental Documents section above. Note that there are minor differences between the Addgene verified sequence and depositor's reference sequence which do not affect plasmid function.