pTXB1-xlH2B(1-114)_K114A
(Plasmid #118217)

• Purpose: Bacterial expression plasmid encoding X. laevis H2B residues 1-114(K114A) as a chimeric fusion to GyrA intein with chitin binding domain at the C-terminus. H2B fragment can be derivatized using MESNa.
• Depositing Lab: Cynthia Wolberger
• Publication: Morgan et al Science. 2016 Feb 12;351(6274):725-8. doi: 10.1126/science.aac5681.

Backbone

• Vector backbone: pTXB1
• Backbone manufacturer: NEB
• Backbone size w/o insert (bp): 6706
• Total vector size (bp): 6998
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: xlH2B(1-114)
• Alt name: Histone H2B N-terminal fragment
• Species: X. laevis (frog)
• Insert Size (bp): 342
• Mutation: Lysine 114 to alanine
• GenBank ID: AJ556871.1
• Promoter: T7
• Tag / Fusion Protein:
  • Mxe-GyrA intein fused to chitin binding domain (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry