Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide3
(Plasmid
#118160)
-
PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA3 against the EGFP CDS
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118160 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR
-
Backbone manufacturerFeng Zhang (Addgene #52961)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKRAB-dCas9-2A-BlastR
-
gRNA/shRNA sequenceGATGCCGTTCTTCTGCTTGT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4907
- Promoter EF1a core and U6
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (destroyed during cloning)
- 3′ cloning site Unknown (destroyed during cloning)
- 5′ sequencing primer GATCCGCCACCATGGATGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: Plasmid contains a N1396S mutation in dCas9. This mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide3 was a gift from Jorge Ferrer (Addgene plasmid # 118160 ; http://n2t.net/addgene:118160 ; RRID:Addgene_118160)