-
PurposeFlourescent reporter for NF-kB activity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118094 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSIRV
- Backbone size w/o insert (bp) 4878
- Total vector size (bp) 5598
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsTest 2-3 colonies to ensure the intact plasmid is selected.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeCFP
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter minimal promoter with NF-kB responsive element
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer GAGGGTATATAATGGAAGCTCG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSIRV-NF-kB-eCFP was a gift from Peter Steinberger (Addgene plasmid # 118094 ; http://n2t.net/addgene:118094 ; RRID:Addgene_118094) -
For your References section:
Assessment of costimulation and coinhibition in a triple parameter T cell reporter line: Simultaneous measurement of NF-kappaB, NFAT and AP-1. Jutz S, Leitner J, Schmetterer K, Doel-Perez I, Majdic O, Grabmeier-Pfistershammer K, Paster W, Huppa JB, Steinberger P. J Immunol Methods. 2016 Jan 15. pii: S0022-1759(16)30007-2. doi: 10.1016/j.jim.2016.01.007. 10.1016/j.jim.2016.01.007 PubMed 26780292