p5-79
(Plasmid
#118087)
-
PurposeN-29-1 split N-terminal T7 RNAP variant-GGSGSGSS-FRB expression plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118087 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonecustom
- Total vector size (bp) 3285
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameN-29-1 split N-terminal T7 RNAP variant-GGSGSGSS-FRB expression plasmid
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTTGCGTTTCTTTTATATGTTGCCACCTTT
- 3′ sequencing primer taaacaactaacggacaattctacctaG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p5-79 was a gift from Bryan Dickinson (Addgene plasmid # 118087 ; http://n2t.net/addgene:118087 ; RRID:Addgene_118087) -
For your References section:
Evolution of a split RNA polymerase as a versatile biosensor platform. Pu J, Zinkus-Boltz J, Dickinson BC. Nat Chem Biol. 2017 Apr;13(4):432-438. doi: 10.1038/nchembio.2299. Epub 2017 Feb 13. 10.1038/nchembio.2299 PubMed 28192413