-
PurposeExpresses EB1-EGFP in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118084 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEF1α-IRES-EGFP
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman EB1
-
SpeciesH. sapiens (human)
-
Entrez GeneMAPRE1 (a.k.a. EB1)
- Promoter EF1 alpha
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sfi (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer TTCTCAAGCCTCAGACAGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please refer to pLenti-IFT20-EGFP for cloning info.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-EB1-EGFP was a gift from Ken-Ichi Takemaru (Addgene plasmid # 118084 ; http://n2t.net/addgene:118084 ; RRID:Addgene_118084)