Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMST-710
(Plasmid #118078)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118078 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMST665
  • Backbone manufacturer
    Sarkari et al. 2017
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA1 (CexA)
  • Species
    A. niger
  • Insert Size (bp)
    246
  • Promoter pmbfA

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGGTCACCCCTAGAGACAGTGA
  • 3′ sequencing primer TGATGTTGAGGGACTATCATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMST-710 was a gift from Michael Sauer (Addgene plasmid # 118078 ; http://n2t.net/addgene:118078 ; RRID:Addgene_118078)
  • For your References section:

    Engineering of the citrate exporter protein enables high citric acid production in Aspergillus niger. Steiger MG, Rassinger A, Mattanovich D, Sauer M. Metab Eng. 2019 Mar;52:224-231. doi: 10.1016/j.ymben.2018.12.004. Epub 2018 Dec 13. 10.1016/j.ymben.2018.12.004 PubMed 30553933