Skip to main content
Addgene

IRES-EGFP-Flag-hRabin8
(Plasmid #118073)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118073 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEF1α-IRES-EGFP
  • Backbone manufacturer
    gift from Dr. Lemischka, Mount Sinai Medical Center, New York, NY
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human Rabin8
  • Species
    H. sapiens (human)
  • Entrez Gene
    RAB3IP (a.k.a. RABIN3, RABIN8)
  • Promoter EF1 alpha
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sfi (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer TTCTCAAGCCTCAGACAGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    IRES-EGFP-Flag-hRabin8 was a gift from Ken-Ichi Takemaru (Addgene plasmid # 118073 ; http://n2t.net/addgene:118073 ; RRID:Addgene_118073)