IRES-EGFP-Flag-hRabin8
(Plasmid
#118073)
-
PurposeExpresses Flag-tagged human Rabin8 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118073 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEF1α-IRES-EGFP
-
Backbone manufacturergift from Dr. Lemischka, Mount Sinai Medical Center, New York, NY
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman Rabin8
-
SpeciesH. sapiens (human)
-
Entrez GeneRAB3IP (a.k.a. RABIN3, RABIN8)
- Promoter EF1 alpha
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sfi (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer TTCTCAAGCCTCAGACAGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
IRES-EGFP-Flag-hRabin8 was a gift from Ken-Ichi Takemaru (Addgene plasmid # 118073 ; http://n2t.net/addgene:118073 ; RRID:Addgene_118073)