Skip to main content
Addgene

pLenti-EGFP-Rabin8
(Plasmid #118072)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118072 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEF1α-IRES-EGFP
  • Backbone manufacturer
    gift from Dr. Lemischka, Mount Sinai Medical Center, New York, NY
  • Backbone size w/o insert (bp) 10000
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human Rabin8
  • Species
    H. sapiens (human)
  • Entrez Gene
    CBY1 (a.k.a. C22orf2, CBY, Chibby1, HS508I15A, PGEA1, PIGEA-14, PIGEA14, arb1)
  • Promoter EF1 alpha
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sfi (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer TTCTCAAGCCTCAGACAGTG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pLenti-EGFP-hChibby1 (Plasmid #89770) was digested with SfiI, and a PCR-amplified human Rabin8 cDNA was ligated in frame with EGFP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-EGFP-Rabin8 was a gift from Ken-Ichi Takemaru (Addgene plasmid # 118072 ; http://n2t.net/addgene:118072 ; RRID:Addgene_118072)
Related items:
Commonly requested with: