Skip to main content
Addgene

Flag-Rabin8
(Plasmid #118070)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118070 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCD-betaG-FLAG
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human Rabin8
  • Species
    H. sapiens (human)
  • Entrez Gene
    RAB3IP (a.k.a. RABIN3, RABIN8)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GCGTGCCTAATGGGAGGTCT
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Flag-Rabin8 was a gift from Ken-Ichi Takemaru (Addgene plasmid # 118070 ; http://n2t.net/addgene:118070 ; RRID:Addgene_118070)

  • For your References section:

    Chibby promotes ciliary vesicle formation and basal body docking during airway cell differentiation. Burke MC, Li FQ, Cyge B, Arashiro T, Brechbuhl HM, Chen X, Siller SS, Weiss MA, O'Connell CB, Love D, Westlake CJ, Reynolds SD, Kuriyama R, Takemaru K. J Cell Biol. 2014 Oct 13;207(1):123-37. doi: 10.1083/jcb.201406140. 10.1083/jcb.201406140 PubMed 25313408
Related items:
Commonly requested with: