Flag-IFT20
(Plasmid
#118033)
-
PurposeExpresses human IFT20 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118033 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCD-betaG-FLAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman IFT20
-
SpeciesH. sapiens (human)
-
Entrez GeneIFT20
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCGTGCCTAATGGGAGGTCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Flag-IFT20 was a gift from Ken-Ichi Takemaru (Addgene plasmid # 118033 ; http://n2t.net/addgene:118033 ; RRID:Addgene_118033)