Skip to main content
Addgene

pXPR003-sgTP53-3
(Plasmid #118021)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118021 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pXPR003
  • Backbone manufacturer
    Feng Zhang Lab
  • Backbone size w/o insert (bp) 9482
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgTP53-3
  • gRNA/shRNA sequence
    CCCCTTGCCGTCCCAAGCAA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    100
  • Entrez Gene
    TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer hU6
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Low efficiency of TP53 deletion

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR003-sgTP53-3 was a gift from William Hahn & David Root (Addgene plasmid # 118021 ; http://n2t.net/addgene:118021 ; RRID:Addgene_118021)

  • For your References section:

    Mutational processes shape the landscape of TP53 mutations in human cancer. Giacomelli AO, Yang X, Lintner RE, McFarland JM, Duby M, Kim J, Howard TP, Takeda DY, Ly SH, Kim E, Gannon HS, Hurhula B, Sharpe T, Goodale A, Fritchman B, Steelman S, Vazquez F, Tsherniak A, Aguirre AJ, Doench JG, Piccioni F, Roberts CWM, Meyerson M, Getz G, Johannessen CM, Root DE, Hahn WC. Nat Genet. 2018 Oct;50(10):1381-1387. doi: 10.1038/s41588-018-0204-y. 10.1038/s41588-018-0204-y PubMed 30224644
Related items:
Commonly requested with: