pBAD/CURT_fluoB
(Plasmid
#117999)
-
PurposeExpression of CURT_fluoB controlled by the ARA promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117999 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBAD
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3956
- Total vector size (bp) 4997
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCURT_fluoB
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)1041
- Promoter ARA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGCGTCACACTTTGCTATG
- 3′ sequencing primer ACTTCTGAGTTCGGCATGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe mCitrine coding sequence was originally obtained from the pET mCitrine LIC cloning vector (a gift from Scott Gradia (Addgene plasmid # 29771)).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD/CURT_fluoB was a gift from Mathias Pribil (Addgene plasmid # 117999 ; http://n2t.net/addgene:117999 ; RRID:Addgene_117999) -
For your References section:
Membrane-bound protein scaffolding in diverse hosts using thylakoid protein CURT1A. Behrendorff JBYH, Sandoval-Ibanez OA, Sharma A, Pribil M. ACS Synth Biol. 2019 Mar 18. doi: 10.1021/acssynbio.8b00418. 10.1021/acssynbio.8b00418 PubMed 30884945