Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

sfTq2-PBP5
(Plasmid #117959)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117959 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTHV037
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Add 0.5% glucose to repress expression
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    sfTq2-PBP5
  • Entrez Gene
    dacA (a.k.a. b0632, ECK0625, pfv)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer GCACTCCCGTTCTGGATAATG
  • 3′ sequencing primer TTATCAGACCGCTTCTGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sfTq2-PBP5 was a gift from Tanneke den Blaauwen (Addgene plasmid # 117959 ; http://n2t.net/addgene:117959 ; RRID:Addgene_117959)
  • For your References section:

    Superfolder mTurquoise2(ox) optimized for the bacterial periplasm allows high efficiency in vivo FRET of cell division antibiotic targets. Meiresonne NY, Consoli E, Mertens LMY, Chertkova AO, Goedhart J, den Blaauwen T. Mol Microbiol. 2019 Apr;111(4):1025-1038. doi: 10.1111/mmi.14206. Epub 2019 Feb 28. 10.1111/mmi.14206 PubMed 30648295